Wednesday, July 31, 2019
Dubai Residents Nowadays Spend Too Much on Shopping
Yes it is agreed as it is a young modern city transformed from a desert, hence has taken the best of the cities to make it the best . As a result the bench mark of lifestyle is high for e. g. : cars, designer labels are imported as Dubai doesn’t manufactures it, therefore consumer has to pay if he wants. These luxuries are a necessity be it as a means of travel etc. However the city is new and has many multicultural populations hence results in various demands. There are various reasons for shopping in Dubai such as brand addiction, status symbol etc, another reason is that the activities are limited and visits to shopping malls results in shopping. Growing trends of shopping noticed in dubai in last few years in resident of dubai. Every person who lives in dubai now are more into the shopping phobia. Above statement is stated on use of following attributies : 1. Financially Stable Country 2. Highest Salary Graph 3. Brand Abundance 4. Geographical Location 5. Fashion In The Air 6. Unlimited Advertisement. 1) Dubai is nowadays people around the world are seen seeking interest in setting up their business entities in Middle East and mostly Dubai . Furthermore according to H. H Shk Muhammad Bin Al Rashid Al Makhtoum (Vice president and ruler of Dubai ) stated that in previous two years people are having more confident to invest their money in Dubai as it has been financially stable during the recession whch took place in 2008 , the evidence to it is that however there was recession in the country but it did not effect the ambition and addiction of residents on shopping , it was seen that shopping malls were seen crowded every season , which makes one say that Dubai is Financially Stable Country . ) The Second reason of why Dubai Residents spend too much money on shopping is that the salary graph is noticed to be increasing day by day which is cause of getting addicted to shopping , it can also be referred as excess of money , however because of this increasing salary residents are addicted to buy branded product to maintain their status in society. Studies have established that UAE has the regions highest individual spenders, with each of its 8. 2 million people spending an average amount of $21,577 (Dhs 79,522) per annum . (Arab Monetory Fund 2010). The world highest apparel sales per capital is at $785 (Dhs 2,865) . At kearney’s Global Retail ) . Furthermore most of the Housewives in Dubai spend their time in kitty parties and other social activities , and for these activities they spend a bunch money on brands , beauty saloon , spa , designer label clothes etc . However these are afforded only because there is increase in salary which eventually increase the addiction to shopping. Hence the salary graph plays an important role in shopping addiction among the residents of Dubai . 3) Brand Abundance is said to be one of the major cause of over expenditures on shopping attitude in Dubai residents. As the financial stability hits the region of Dubai every major brand outlet is easy to find in Dubai , due to number of malls and various brands stores. This makes Dubai resident more brand conscious and as a result overexposure to labels , brands and novelties are found in Dubai. Which maintains the habit of shopping among Dubai Residents. This also makes a reson for every brand to target Dubai as the consumption is seen more in this part of Middle East. Such is the case with Bloomingdales , Parada , Nichols and many other brands . ) Geographical Location is Excessive shopping happened in dubai is because of geographical location. The geographical location of the city also favors excessive shopping. Dubai has a hot and moist type of weather. For that cause, people are ambitious to the big air-conditioned shopping malls. There, they are over depiction to the advertisement and charisma of the major brands and that makes them shop more. Brands here are merely profit-oriented, and do n ot run environmental campaigns in the park or on the beach, but in the mall. Also, as it was previously talk about Dubai is a shopping hub due to the city’s geographical location. People from China, Saudi Arabia and Europe visit Dubai on a holiday or simply on a shopping extravaganza from corner to the malls. It seems that this propensity for shopping is reflecting on Dubai residents as well. Whenever you go out, and that means most of the time to the shopping mall, you see beaming tourists carrying a multitude of glossy shopping bags. 5) Fashion in the Air A number of power events like Dubai World Cup horse racing or the Oil Barron’s Ball, and never-ending product launches require attendants to dress to the occasions where often they are judged on their outfits by the rest of the crowd. As a result, people have become highly fashion conscious and this is another reason why are Dubai residents addicted to shopping. 6) Unlimited Advertisement is advertising during the past few years become repressive, obtrusive and time-consuming for most of the people who live in Dubai. Since the moment you awake and turn the radio on, you get attacked with offers and promotions. When you drive around Dubai, you see advertisement everywhere and in all forms, from billboards to TV screens. Public transport is one of the major source the brands are using for their advertisements. Such as; * Nowadays, the movies in the Reel Cinema start 25 minutes later, because the cinema makes huge chunk of profit by showing its public a rich variety of advertisements. * This is understandable, but up to some extent! Five ads at the time are quite enough for most of the people, but in Dubai you get to see 35 or more various advertisements before the film starts. The inferior advertisement seller is the TV network. A TV show that is supposed to last 35 minutes, for example, consists of approximately 21 minutes advertisement and 14 minutes content. In addition, the TV ads are literary stuffed by 20 or even 25 in blocks of approximately five minutes each. For example, during â€Å"The Entrepreneur†TV show of 35 minutes, you can watch 4 or 5 times the same advertisement for Coca-Cola. This is no longer even an effective advertisement, because it doesn’t inspire you to drink Coca-Cola, but boars you. In many countries around the world, TV advertisement is regulated by law. Industry experts say that in the United Kingdom, for every one hour of TV program viewers should see 9 minutes of advertisement. In the United States, the norm is stretched to 17 minutes of ads for each hour of show or film. (London Hilton mallâ€â€- 2011 Peoples from dubai spends around 100 million pounds due to Olympics 2012 last year they are unable to get more business from the same gentry but currently they are expecting 150 million pounds business from these peoples in 2013. ) According to a survey Only one in five people, or 35 percent of UAE respondents, said luxury was â€Å"over and above what you need†, the Synovate survey of 8,000 people in 11 countries found. This attitude comes from the large number of designer shops, high-end hotels and plush shopping malls in the emirates, said Per-Henrik Karlsson, Synovate’s business development director in Dubai. â€Å"This creates aspirational behaviour among expats, tourists and locals alike. It starts even before you arrive, as the Emirates Airlines pre-landing video about Dubai is all about shopping, luxury cars and hotels,†â€Å"And once on the ground, it's everywhere: the main highway is full of billboards advertising luxury brands. Even eating out in Dubai is part of this lifestyle, with some luxury brands operating their own food and beverage outlets in malls. The Middle East mass luxury goods sector is set to grow 10 percent a year, Bahrain's Investcorp said earlier this year, boosted by the region’s young population and relative wealth. The survey found the UAE was also among the top locations for logo-branded goods, with 58 percent of residents saying they preferred to buy designer items. The other two countries were India, with 79 percent and Hong Kong with 68 percent. The country with the lowest percentage of people preferring logos was the UK with 46 percent. â€Å"Showing off logos is not seen as bad taste; whether it's old or new money doesn't matter nearly as much as simply having money! In fact, another newly popular trend here is buying brands that sport oversize logos, like certain shirts – the more ostentatious, the better,†Karlsson said. Another statistic to come out of the survey, published in December, was that 14 percent of people in the UAE most value the feeling â€Å"that I have something my friends and colleagues do not have†. Twenty three percent of UAE residents said they purchase luxury items â€Å"As soon as I decide I want it, I buy it†– the second highest figure behind India with 28 percent. However, consumer confidence was reported to have slipped for the first time in the UAE since March, the latest quarterly survey by Bayt. com and YouGov Siraj found. (ByElsa Baxter , Tuesday, 12 January 2010 8:03 AM , business . com ) Thus it can be concluded stating that though the addiction of shopping is seen in Dubai residents but however it is increasing the economy of Dubai as there is more consumption and every one in Dubai is buying them whether it be a person of any classified category , the biggest reason which seen and heard it that to maintain the status in society .
Tuesday, July 30, 2019
DNA
Long stands of double helical DNA can fit into the nucleus of a single cell because DNA is specially packaged through a series of compaction events to fit easily within cell nuclei. Even though the length of DNA per cell is about 100,000 times as long as the cell itself, it only takes up only about 10 percent of the cell’s volume. The DNA molecule, in order to condense, wraps itself around groups of histone proteins, and then the chromatin folds back on it, nucelosomes pack together to create a compact, protein-coated fiber, and the fiber coils to shorten further into an extended chromosome. Finally, the coiled fiber organizes into loops coming from a central axis, creating a condensed, X-shaped chromosome. 2.Why is a sport drink used to collect the cheek cells instead of water? Sports drink which is saline solution contains sodium chloride which makes the solution compatible with osmotic environment of the cells. The sports drink prevents the cells from breaking open and releasing their DNA before they are collected. If water was used, it would be hypotonic to the cells causing them osmosis and eventually burst. 3.What does the cell lysis solution do to the cells’ membranes? It dissolves the phospholipids bilayer of cell membrane by forming water soluble complexes with them 4.How does the DNA in the cell lysate become visible? It becomes visible when ethanol is added. Since DNA is insoluble in ethanol, it cannot be incorporated into the liquids. Ethanol hits the cell lysate which cause the DNA to precipitate out of the solution, forming a cloud of stringy fibers at where ethanol and cell lysate meet. 5.Why can you see the extracted DNA with the naked eye? I can see the extracted DNA with the naked
Accounting-Pest Analysis-Political Essay
PEST Analysis Political The international IT and electronics industries have been characterized with intensive competition. Electronics and IT companies are constantly reviewing their achievements as well as the competitors’ in order to come up with better business strategies in an effort to best all other existing industry rivals. With the merger and acquisition strategy between HP and Compaq, members of the IT and electronics industry all over the world were threatened with the intensified effort that could result from the integration. Others were surprised because mergers and acquisition strategies may also result to negative implications on the part of the merging companies particularly when differences in the context of strategies, culture and goals fail to be fully integrated. Economic For HP and Compaq, the merger will increase the competitiveness of the previously independent companies in order to outdo the achievements of highly aggressive competitors. Both HP and Compaq sought means to add value to their existing products and services in order to increase the level of satisfaction among their clients and customers which were made possible through the merger. Once satisfaction levels among clients and customers are met, HP-Compaq expect better economic competitiveness within the international IT and electronics industry. Social The existing companies have been on guard when it comes to new market trends, new market opportunities, new customer bases, and technological infrastructure available for utilization. The merger between HP and Compaq will most likely result to better social activities as sponsored by the merged companies. Social and civic activities that were previously independently supported by HP and Compaq will be carried out in new perspective due mostly to the fact that the merger could expose unexpected factors that could make the new company unstable. Technological One of the primary reasons for the merger of HP and Compaq are the companies’ drive towards innovation and development in their products and services. The merger enabled relatively stronger research and development efforts for the benefit of the new company since it is now characterized with more intensive concerns to come up with IT products and services that will cater to existing as well as new clients and customers thereby increasing the companies’ consumer bases. At present the electronics products of HP have been observed to undergone evolution with the support facilities which were made available by Compaq. Five Forces Analysis Suppliers The merger resulted to review and assessment of the existing suppliers of both HP and Compaq since the integration strategy implied the relatively fewer contracts between companies that provide similar services and raw materials to HP and Compaq. However, the integration likewise resulted to innovation in technology which necessitated new contracts with suppliers that can provide the new services and raw materials needed by HP-Compaq as a single corporation. Buyers With the promised added value on the products and services of the HP-Compaq merger, clients and customers of the company could expect new and better product lines and service offers as one of the primary objectives of the integration strategy. Buyer power will be intensified in this respect since the HP-Compaq will be offering new electronics products and services in order to set new market trends in the international IT and electronics industry. Competitors Competitors of HP and Compaq were somehow divided when it comes to the overall implications of the merger to the international IT and electronics industry. There are those who believe that the merger will result to the continuous weakening of both companies compared to their other stronger competitors in the international IT and electronics industries. While some believe otherwise due to the increased capability of HP and Compaq as a single operating company to build up and strengthen the market positions in the future years that will come. Substitutes Substitute products and services are increasing within the international IT and electronics industry which contributed to the integration decision between HP and Compaq. With the conglomerate efforts between the new HP-Compaq corporation, it is expected the substitute products and services that competes with the provisions and offers of HP-Compaq will be lessen due to better production and manufacturing processes and technological infrastructures that cannot be afforded by small rival companies. New Entrants New entrant in the electronics and IT industries are confronted with relatively more difficult entry to the international market due primarily to highly aggressive competition between and among large corporations. It is common knowledge that business operations and facilities that characterize both the international IT and Electronics industries are very expensive and sophisticated. Such factors serve as strong barriers of entry to the industries where HP-Compaq belongs. SWOT Analysis Strengths The merger between HP and Compaq will increase the companies’ competitiveness when it comes to the possible new product lines and services that they will offer as a single company to the clients and customers. The integration strategy likewise resulted fewer market competition within the context of large international corporations that also belong to the international IT and electronics industry. Costs will be reduced as expenditures in business operations such as manufacturing and production are now handled and managed as a single proprietorship. The research and development arm of HP and Compaq can now work together as single company with similar technological and economic goals. Weaknesses The integration strategy between HP and Compaq, on the other hand, resulted to the need to lay off thousands of employees since their services will be no longer needed particularly those who have similar functions. Cultural integration within the workplace is also a serious issue since HP and Compaq are composed of different individuals and employees who are used to different working environments as well as career expectations. The Human resource department will be confronted with problems and issues regarding the new members of the company’s workforce. Technical operations will also experience drawbacks from the changes that will transpire within the business processes of the company. Opportunities The issues and problems that may result from the merger in terms of workforce differences can be perceived as an avenue fro improvement when it comes to workplace culture of the company. The management should be able to device means to exhaust diverse knowledge and skills that characterize the members of the company’s labor force. Operations should likewise be restructured and reengineered in order to come up with better manufacturing and production processes that take into account efficiency and product quality. Threats The failure of the merger strategy is also possible if HP and Compaq are not able to resolve issues caused by differing workplace cultures. The vulnerability of the merged company is likewise exposed since it is only a couple of years since the merger contract was signed. There is still so much to do for the full implementation of the merger strategy and existing competitors will aggressively take the opportunity of the changes that transpired within the new HP-Compaq company. Both internal and external factors may contribute to the challenges and difficulties that HP-Compaq will experience in the future in the effort to succeed in the international market competition. Strengths Hewlett-Packard’s primary strength is its business position. The enterprise has a large amount of cash in hand about $10 billion. Hewlett-Packard is a global enterprise and especially after its merger with Compaq, the company became world’s biggest computer hardware and peripherals consort in the world and has ranked 20th in the Fortune 500 list. Hewlett Packard is operating in more than 170 countries including both developed as well as under-developed. Being a global dealer of computer hardware, it gives HP many advantages like dominating printers market, both laser and inkjet. The company attracts and focuses on consumers from even newly found markets all around the world, multinational corporations, non-governmental organizations etc. The company compete both at local and international level. It has increased its competitiveness through policies and strategies that supports free-market economies. This is one of the reasons that make HP a leading supplier in the growing IT markets. Hewlett Packard is said to have a complete product port folio. Weaknesses The company was in a long term debt for many years which kept it from investing in different growth opportunities. A major problem and complaint about the hardware supplies of HP is its touch pads. The touch pads of the notebooks of Hewlett Packard like the dv series, dm3, and Envy lines needs improvement. These touch pads are either finicky, unreliable, or are difficult to use because of friction. The mouse buttons on various HP supplied machines are said to be clumsy to use, too. Poor shelling life of HP products plagued some mainstream systems and net books. When it comes to Software that HP provides there are also some weaknesses. Some heavy software’s were paired with slow hardware like Touch Smart. The past acquisition of Peregrine made the HP’s portfolio even more diverse and complete but HP Open View’s lack of mainframe management capabilities created several problems. Another weakness was that it did not yet hit a CMDB product that includes discovery and mapping. This cause many customers to switch the brand. Opportunities The recent acquisition of EDS puts HP at a strong position in the computer market and makes it portfolio more impressive. Hewlett-Packard was able to generate large number of revenues and profits from its different deals and raised more than six billion which it can use to pay off its debts as well as invest in different research and development activities. If the products by the company are supplied at reasonable prices, there will be more chances of growth as the demand would increase. The company has formed Customer Solutions Group that helps in selling the complete IT solutions, products and services by HP. Threats Operating in global market means many competitors and therefore, the company has to be at the forefront of changing technologies as well as addressing the changing customer demands and needs. The global economic recession is also a threat for the company’s sales and profits. The prices have also fallen as the stock markets are at historic low positions. Many other competitors including Dell are entering the printer business whereas IBM has become a market leader.
Monday, July 29, 2019
Analysis of Space Exploration Essay Example | Topics and Well Written Essays - 750 words - 3
Analysis of Space Exploration - Essay Example The government and NASA have conspired to brainwash the ordinary person with these images, with the aim of grossly exaggerating the budgetary allocations assigned to NASA in every financial year. The statement put across here is that success in space exploration can only be achieved through government funding by employing billions of dollars to fund NASA’s space exploration operations. This statement is a fraud that the government and NASA would have us believes to be the only strategy of achieving success in space exploration programs. NASA would have us believe that extravagant expenditures are the only way of reaching an advanced technological breakthrough in space exploration. However, this is not true, because space technology can be easily equated to an expensive toy, which is flashy and exciting while new but irrelevant and outdated once it has outlived its uses when newer and more exciting toys hit the market shelves. Although government funding is necessary for space exploration, it does not necessarily mean that the funding has to be stretched to billions of dollars begotten from the public coughers. Space exploration may be expensive, but this does not necessarily mean that NASA should ask for exorbitant finances from the government for their space operations. This is because expensive technology does not essentially translate to operation success, but rather a chance at innovation to develop simple, efficient, and cost friendly space technologies. NASA should not, therefore, employ the ‘sledgehamme r’ approach to space technology, where they employ the sophisticated technology card to every challenge faced by the program. Instead, the government should provide limited funding, which is centered upon responsible spending and efficiency of space exploration technology. Â
Sunday, July 28, 2019
Proposal Argument - Overcrowded Prisons Essay Example | Topics and Well Written Essays - 1000 words
Proposal Argument - Overcrowded Prisons - Essay Example Any person who finds guilty of committing crime is likely to face consequences of punishment from the legal system of the nation (Darrow, pp. 6-10). The behavior of the person after punishment will change and make the person a better one is under many controversies and quarrels as the studies’ results have shown different findings in each case. For the last few decades, crime and criminal activities has boosted drastically and become one of the serious issues for the entire human race. The criminal acts not only affects the criminals, their families, and victims but has effects largely on the society as whole. The ratio of increase in crime factor is resulting in the increase of prisons as well to accommodate the prisoners (Darrow, pp. 11-13). In order to control and alleviate the facet of crime in a state or nation and to provide security to its citizens, the justice system is existent. As the country is powerful and economically stable, it proves that the justice system is w orking in the right path resulting in the growth of the state. United States of America is one of the countries that are considerably a superpower state with an influential justice system. Despite of having a strong justice system, observations has come into limelight that the proportion of people involved in the criminal activities has increased at an unprecedented rate with the passage of time. The criminals are not restricted to gender and both males and females are largely engaging themselves into such actions and behaviors (Clear, Cole & Reisig, pp. 460-470). According to the statistics of researches, it has come under conclusion that the rates of crime in the U.S. regions have far more than that of countries in the other regions of the world and has materialized in the last few decades. The consequence of the increase in crime, the jails, and prisons are now overfull and congested. The result of overcrowding makes the authority of the prisons to adjust criminals that are in do uble quantity now in the prison cells that came under plan for single. Another consequence of the crime rate raising is that there is a lack of beds for the criminals for which they keep them into the jails that are far away from their home. Increase in transportation cost is an outcome of it, also making delays in the justice as it takes more time to reach for court appearances. In addition, there is a high risk involved that subsequent to the release, the prisoner will not be able to re-incorporate amongst his family members and the society (Pollock, pp. 65-67). The growth of prisoners is creating a negative and unconstructive impact, as jail authorities are carrying out no productive and beneficial work for the inmates that could lead them to be a better person in future. According to the researches that have conducted, it has come under evidence that very little measures have come under performance for the prisoners in educating them and providing them with the employment opport unities (Pollock, pp. 67-71). The prison environments play a vital role and are of great deal of importance in the formation of the inmates’ attitudes. If the prison environm
Saturday, July 27, 2019
Answer these questions Essay Example | Topics and Well Written Essays - 750 words
Answer these questions - Essay Example In the campaigning groups, for instance, Protestants who are morally upright will discourage rivalry. This creates political sanity in the country, enabling smooth flow of the political realm. It also develops convenient answers to complicated questions, therefore cubing fears while guaranteeing reassurance for the future. According to Islamic religion, the Muslims need to, not only do good to the public, but also influence and impact the public to do good. This is stated in the holy quran 12:55-56. The Muslims join the politics in order to influence the governments to do good. They believe they may not be heard while they are outside the political arena. In an example, Prophet Yusuf, living in a non Muslim country, was asked to be appointed to head the national treasury, he said â€Å"Set me over the store-houses of the land; I will indeed guard them with full knowledge†This is according to the Qur’an. Muslims also believe that they are known to revenge on any any offence against them. The implication of this is that they will always cause chaos wherever they go. To change this perspective in the minds of people, they have to be elected to the national dockets so as to reach the public and change the negative image they have in the public. Practices associated with religion, for example, Literature, arts, music, and traditions are obvious for they have brought many people together enhancing unity among people of different interests. They develop a specific culture, in which the common people have shared practices. The stories within the Bible, like the story of King David and how he became a leader of Israel, have teachings that can be drawn by the modern leaders to shape their moral behavior. An example is when King David became remorseful when he killed Uriah and lay with his wife. From this context, men can always reconcile with people they have wronged while they are in
Friday, July 26, 2019
Is Hate Speech in the Media Directly Affecting our Culture (responses) Assignment
Is Hate Speech in the Media Directly Affecting our Culture (responses) - Assignment Example Henry is of the opinion that the kind of culture portrayed in the media makes human being lose their sense of humanity. By watching violent behaviour on television children tend to adopt what they have seen in the media. Societal degradation is rife and rising in the name of entertainment and glorification of America. People no longer care about each other and the poor and homeless are considered lazy. In his response he states that ‘†¦ many groups who are considered marginal because they are poor, unemployed, people of color, elderly or young have not just been excluded from the American dream but have become utterly redundant and disposable waste products of a society that no longer considers them of any value’. He adds that suffering and violence is applauded and recognized in holly wood. The homeless and poor are seen as a burden to the state and instead of having compassion for the homeless, homelessness is considered a crime. He adds that sleeping, sitting, soliciting lying down or loitering in public places is considered a criminal
Thursday, July 25, 2019
Explain Descartes skeptical argument according to a prompt Term Paper - 1
Explain Descartes skeptical argument according to a prompt - Term Paper Example The fact that while we are sleeping and still see ourselves in other places doing other things raise a question about dreams. For example, you see yourself in a lecture room attending a specific lecture, but at the same time you are in your bed sleeping. This raises a question of how often we sleep at night You might argue that the brain plays images of events that were recorded during the day. Nevertheless, the images that we see in dreams are not things that occurred in the past are going to happen in the future (Simpsons 67). Thus raising the question where do dreams come from and what do they represent. There are many definitions as to what dreams are and what they represent. Most of the definitions are based on research and religion. Dreams are a sequence of views, pictures and feelings that happen while a person is numb. Dreams occur while asleep because there are parts of the brain that are most active while the body is resting. The process of having dreams is referred to as dreaming. At times, we can have more than two dreams in one night. Conclusions in dreams are not always clear because we wake up while they are about to end. It is said that we all dream, but not everyone remembers his or her dreams vividly (Bryant 2). With this in mind, how then can we explain a person who sleeps walks? Research has shown that sleepwalkers are indeed dreaming. The difference being that the dreams that they have, process communication in the subconscious levels and give messages to other body organs in order to operate them. Descartes says that there are no conclusive signs that show the distinction between being awake or asleep. The difference being dazed only supports the conception that we may be sleeping (Hill 6). In the first meditation, Descartes states that we cannot have knowledge of the external world and our bodies based on the senses. To strengthen his argument, he uses the dream argument. He states that we cannot have knowledge of the external
Wednesday, July 24, 2019
NONE Essay Example | Topics and Well Written Essays - 1250 words
NONE - Essay Example Asymmetric information refers to a situation where participants in a particular market have different information. In the case of credit markets, borrowers may know more information regarding their credit worthiness more than the lenders. Another element that brings about imperfection is limited commitment. It refers to situations where parties to a particular contract are not willing to fulfill their obligations. Lenders will usually use collateral to offset the adverse effects of limited commitment. One of the main effects of the two imperfections is that borrowing can only take place against collateral, such as buildings, land, and machinery. The case will affect the ability of the households and firms to borrow because of changes in the value of collateral (Filardo et al. pp, 11-37). Economists have consistently made the assumptions that the credit market is perfect. However, this assumption is not accurate because of the frictions that take place in the market. The frictions mentioned above are of particular interest to any economist. The diverse effects that are they impact on the market cannot be. It is why there is a need for an economic framework that embraces intermediation because frictions can impede the crucial supply of credit in the market. An assumption that the market is perfect would be against the realities of the economy. The effects of frictions are in various economic fields such as the investment decisions, consumption/savings behavior, economic growth and the transmission of monetary policy (Bernanke et al. pp. 17-51). Changes in the credit market condition will result in the amplification and propagation of the initial effect of first real or monetary shocks. Shocks are unexpected and unpredictable events that affect an economy these factors may be positive or negative. Exogenous factors have an impact on endogenous economic variables; the economic variables that respond are output and employment. The
Research Commision on Theatre Tradtion Nautanki Essay - 1
Research Commision on Theatre Tradtion Nautanki - Essay Example It is a roving theatre form, today considered to be a little uncouth by educated Indians; but could also be called as folk dance, village drama etc. It is a rural version of the word, natak, meaning drama in Sanskrit and according to a legend, the word nautanki might have come because it was the name of a princess and the initial dramas were about her love story which eventually signified a theatre genre. â€Å"Nautanki is staged in courtyards and maidans. The music is not exactly classical or even folk but has a pattern of its own, which does not vary much from drama to drama. The poetry is written in various metrical patterns and sung according to a special convention. The prominent musical instrument is the nagada (a single-faced kettle drum) which, in fact heralds a Nautanki performance. The sarangi and harmonium are also used. The dholak (drum) provides the rhythm†http://www.indiaprofile.com/religion-culture/nautanki.htm Nautanki is based only in North India, especially in the states of Bihar, Uttar Pradesh and Punjab. To give a brief history of this operatic drama, it is important to know that they started as musicals, evolved out of ballads and recitals, with emotional drama and elaborate gesticulation, stories focussing on heroes and anti-heroes of the society, usually performed on a make-shift platform, starting with the invocation of God. It is not only the stage, but the surrounding trees, building, windows, doors or any other decorative items that simply happened to exist adjacently could be used as part of the play to make it more authentic. The rural folk enjoyed the high drama in it and it applied to all the religions and cultures. Even today it is considered to be a highly secular dance form, where stories from all the religious mythologies are performed and appreciated. It starts with Ranga’s (Director or the main person) singing, supported by harmonium accompanied by scintillating different
Tuesday, July 23, 2019
Personal Development self -managemnt and reflection Assignment
Personal Development self -managemnt and reflection - Assignment Example Section 1 There is a number of skills that one need to posses in order to successfully go through the Higher Education system. One of the most important personal skills that one should have is organizational skills, this skill is very important because it assist an individual to plan wisely and manage time well and bit any deadlines set .Having organization skills illustrates that one has a high level of intellectual ability and thus in a position to undertake a higher education course in any field. Determination is yet another skill that a student pursuing higher education should posses, determination is the zeal to keep on working hard until one achieves his/her goals ,.Determination will enable student to focus on achieving his career goals . Communication skills are needed to promote teamwork and collaboration, leadership skills and research skills ,without communication skills a student may not be in a position to smoothly carry out their business around the university .In moder n world the use of information technology and knowledge in numeracy is a must for any student pursuing higher education more over, a student should have problem solving skills, be in a to improve own learning and performance and should practice self discipline. Individually, I understand that I have some weaknesses in some of the skills mentioned; in particular I have gaps in organizational skills, zeal to improve my own learning and performance and I also have poor communication skills. Section 2 Action Plan for Academic skills needed to be attained Skill Target Action Timescale Success Criteria Recourses Organisational skills Excellent organizational skills Have a workable time table in place Become committed to my school work Time management Practice free and effective communication Listen to others Exercise leadership skills 6 months Neatness and clarity in my work Beating of deadlines Excellent grades Fellow students Lecturers Reading material Improving my own Learning and Perf ormance Excellent all round performance Consultation Teamwork Hard work Commitment Motivation 6 months Improved performance Involvement in most activities Reading material Fellow students Family Lecturers Communication Skills Excellent communication skills Stay focused Listen carefully See the point in other people messages Ask for assistance if needed Practice clarity 4 months Improved teamwork Excellent listening skills Excellent organisational skills Improved performance Reading material Fellow students Lecturers Action plan for the four subjects to be covered during the program Subject Target Action Time Frame Success Criteria Recourses Subject one to four Perform exemplarily in the respective subjects Get the core units Understand the topics Visit libraries and other resource centers Carry out in depth research on the subjects Submit all assignment on time Practice teamwork with class mates and lecturers During the course duration Good performance Good communication skills Libr aries, the internet , Fellow students Lecturers Section 3 Topic 1 Understanding this topic was easy for me, this is due to the exciting lecturer we had, and the lecturer was amusing besides being very knowledgeable. I ensured that I would not miss nay lecturer ,personally ,this topic has assisted me to develop my communication and interpersonal skill due to the high level of involvement
Monday, July 22, 2019
The Idea of Free
The Idea of Freedom to the Colonial America Essay Introduction Colonial America never had experienced freedom to its fullest implication from the beginning of their settlement in America. This could be perhaps understandable in the sense that back in England where many of these settlers came from, the expression of freedom had been so limited too. They have no freedom to express their political views nor did they have freedom of religion. The reigning monarchs James I (1603-25) and Charles (1625-49) established a series of â€Å"increasingly repressive laws against the few remaining Catholics and the growing numbers of Protestants in England†[1]These laws triggered religious persecution that drove many people to migrate to America to escape such repressive laws and the resulting religious persecution. The restriction of religious freedom was also imposed in the colonial America although there had been minor enhancement on its implication to the people. The ideas of freedom during the colonial America varies and was religious in nature but was quite vague in a sense that they implement strict laws and imposed very harsh punishment for violations where freedom was restricted. Based on the lecture of Zaheer Ali (September 10, 2008), America was inhabited by Asian Migrant between 16,000-14,000 B.C. particularly North[2] America (. These migrants undoubtedly had enjoyed unaltered freedom for very long period of time as they may have been undisturbed by the repressive or colonial laws experienced by the colonial America. They can do all they want with out fear of getting apprehended for violating restrictive laws. For the colonial America however, the idea of freedom varied and this was partly due to their diversity of ethnic origin. The Lutheran immigrant from Germany for example carried with them their notions of freedom as â€Å"the potential for philanthropic service to God and fellow humans,†[3] So as did the Puritans from England. This implies the absence of religious persecution in which the individual was persecuted on account of his or her faith. The idea about freedom of the Lutherans from western Germany, in contrast with the notion above, held freedom as â€Å"liberation from external coercion, alongside the promotion of inner godliness.†[4] While the first notion was purely religious, the context of this idea sounds a socio-religious which could be referring to the oppressive laws directed against Protestants and other non Catholic faiths. However, these German American ideas of freedom had evolved during the time of American Revolution. Freedom now includes the protection of property, which means that freedom was not only about serving God and fellow human freely, but also living a secured life with out fear that their properties would be confiscated. But for the Immigrants from England, and other Catholic countries, the idea of freedom was associated to freedom to exercise religion. George Kurian, Jeffrey D. Schultz, John G. West, and Ian S. Maclean pointed out that â€Å"the Pilgrims and Puritans came for religious freedom that chiefly meant freedom to practice their religious convictions without constraint from the English authorities.†[5] During this period, the concept of freedom was very narrow and specific in a sense that it only referred to one particular subject. Furthermore, their ideas were quite vague because while they held that freedom was associated to freedom to exercise religion, anyone who would exhibit different expression of faith even from their own ranks, would be severely punished, usually with death. This was the case in Massachusetts in 1659 and 1661 in which according to George Kurian et, al. â€Å"Quakers were outlawed and punishedâ€â€four were even hanged†[6] for proclaiming â€Å"a different version of Christian faith.†[7] This was also the case of Roger Williams which was banished from Massachusetts in 1636. Kurian et, al. stated that William was intensely devout and was one of the â€Å"first to grasp the idea of religious freedom in the sense that we mean it today.†[8] Thus, the notion of freedom during the colonial America, though linked to freedom to exercise religion, does not actually have any room for tolerating different version of exercising their faith or religious practices, other than the prescribed manner, or to tolerate any other religion which was the true meaning of freedom of religion. The Puritans’ idea of freedom were also grounded on religion. Sheldon Hackney stated that for the Puritans in seventeenth-century New England, freedom was â€Å"the ability of their communities to establish a society of their understanding of the Bibl, the kind of Biblical commonwealth they were not permitted to create on Great Britain were the King was the defender of faith and the church of England was the established church†[9] For the Puritans, Freedom was a spiritual thing. It means freedom from enslavement to sin, which could be achieved â€Å"by strict conformity to the will of church and community.†[10] In his speech to the general court in 1645, John Winthrop, leader of the Massachusetts Bay stated, â€Å"On liberty, moral liberty is to be understood in terms of the covenant between God and man, and it is to that only which good, just and honest†¦.This liberty is is maintained and exercised in a way of subjection to authority; it is the same kind of liberty wherewith Christ hath made us free†[11]            These ideas of freedom of the colonial America were a reflection of the social realities at the time in which religion has been the basis of governance and it encompassed every spheres of the society as well as the everyday life of the individual families. Did everyone experience freedom in the same way?            There is no doubt that the expression of freedom in the context of religion was experienced in the same way through out the colonial America even though some states have different religious ideas. Hackney noted, â€Å"Colonial America in general, was not devoted to religious toleration. Anglican in Virginia had very different religious ideas from the Puritans in New England, but they agreed completely about the need of the society for uniformity of worship.†[12] This same experience of the idea of freedom could be attributed to the fact that the issue of religion as the basis of governance was also the standards of the moral and ethical norms of the society throughout Europe and the Americas. The fact that most of the immigrants had migrated to America to escape religious persecution reflects the same experiences that logically breeds the same feelings in which; their idea of freedom were based.            All throughout the American colonial period, the ideas of freedom were influenced by the developments in England particularly the set of power. Notable was the rise to the throne of Mary, the protestant daughter of James II and her husband, William of Orange which paved the way for the objective view of religion and government. It was from this period that the evolution of the ideas of freedom to exercise religion began to find a place in the government which later influenced the declaration of independence of the colonial America.            Generally however, the main issue of freedom was freedom to exercise religion between Protestant and Roman Catholics. It means people experiences tyranny, oppression, injustice, and discrimination on account of their religion. These experiences were common among every state in colonial America as religiosity were the basis of the society’s everyday lives. It is the standard of norms of the society and was the basis of justice. However, this is quite vague because the freedom to choose religion was between Protestant and Roman Catholics only and which ever one chose, affects his or her own life socially, physically, and economically. Moreover, the idea of freedom limits to freely exercise either the Puritan or the Lutheran faith in the traditional manner of worship. It means that the individual were not allowed to have personal interpretation of the word God in a way that will suit to his or her situation and needs. It was a freedom to mean only to exercise the Lutheran and the Puritan faith and practice freely. This vague understanding of freedom had led many colonial states to â€Å"abstain voluntarily from asserting a governmental right to control or regulate religious activity within their territories and jurisdiction†[13] This development in the ideas of freedom was experienced all through out America until the birth of the United States because more and more states had recognized that religious freedom was part of the ideology of America, part of the American’s self concept. Thomas Jefferson according to Guinn once stated that freedom is, â€Å"the most inalienable and sacred of all human rights.†[14] This realization of the value of religious freedom had contributed to idea of freedom which we now enjoy. Conclusion            The social realities in Europe during the 1700s greatly affected the lives of people everywhere. The religious conflict between Protestant and Roman Catholics affected not only people of England but also in most part of Europe where the conflicts were intense. These realities led people to migrate to America.            At first glance, all we can see are the ugly, realities but looking objectively, those ugly realities paved the way for a more meaningful concept of freedom which enabled us to live a more enjoyable and exciting life. It gave our policy makers a more objective understanding and more objective laws that guarantees the individual freedom not only to practice religion but also to express views on governments or to criticize what one perceive to be wrong as long as he or she does not violate the law. Today, we are benefiting from the equal implementation, equal, purpose, and equal meaning of the law regardless of race, sex, color, religion, and ethnic origin, as our laws guarantee not only our freedom, but also our peaceful existence, our rights, and the security of our properties and most all our future. Bibliography Ali, Zaheer â€Å"The American Experience†(Lecture, September 10, 2008). Fahlbusch, Erwin; Bromiley, Geoffrey William; Barrett, David B. The Encyclopedia of Christianity USA: Wm. B. Eerdsmans Publishing, 1999 Guin, David Faith in Trial USA: Lexington Books, 2006 Hackney, Sheldon Magnolias Without Moonlight USA: Transaction Publisher, 2005 Kurian, George; Schultz, Jeffrey D.; West, John G. Maclean, Ian Encyclopedia of religion in American Politics USA: Greenwood Publishing, 1999 Noll, Mark A. America’s God New York: Oxford University Press, 2005 [1] Erwin Fahlbusch, Geoffrey William Bromiley, David B. Barrett, The Encyclopedia of Christianity USA: Wm. B. Eerdsmans Publishing, 1999, p. [2] Zaheer Ali â€Å"The American Experience†(Lecture, September 10, 2008). [3] Mark A. Noll, America’s God New York: Oxford University Press, 2005, p. 116 [4] Noll, p. 116 [5] George Kurian, Jeffrey D. Schultz, John G. West, Ian Maclean Encyclopedia of religion in American Politics USA: Greenwood Publishing, 1999, p. 59. [6] Kurian et, al, p. 59 [7] Ibid [8] Ibid [9] Sheldon Hackney Magnolias Without Moonlight USA: Transaction Publisher, 2005, p. 126. [10] Hackney, p. 126 [11] Ibid [12] Ibid [13] David Guin Faith in Trial USA: Lexington Books, 2006, p.25 [14] Ibid
Sunday, July 21, 2019
The Conduct Of Inter Professional Practice Social Work Essay
The Conduct Of Inter Professional Practice Social Work Essay This study aims to investigate the conduct of inter-professional practice in areas of social and health care, with specific regard to the involvement of service users in such practice. The case study prepared by the City and Hackney Local Safeguarding Children Board on Child A and Child B is taken up for analysis and review in this context. The case study is taken as read and is not elaborated for the purpose of this essay. Health and social care in the UK is currently being significantly influenced by a growing commitment towards greater public involvement in the design, delivery and evaluation of services, greater availability and choice of services for all categories of service users, reduction of inequality, greater emphasis on provisioning of services at the local level, (including from the independent and voluntary sectors), the commissioning process, integration of social and health care, and professional roles for delivery of care on the basis of actual needs of service users (Barrett, et al, 2005, p 74). Such reforms call for the blurring of strict boundaries between the different professionals and agencies working in health and social care (Cowley, et al, 2002, p 32). They also call for greater inter-professional and inter-agency working and for significant alterations in organisational cultures in order to enhance the power base of service users and members of the public in different aspects of social care provision (Cowley, et al, 2002, p 32). It is now widely accepted that health and social care professionals need to be more responsive to the rapidly changing needs of service users. Such changes call for the development of health and social care practitioners to improve care for clients and service users (Day, 2006, p 23). Such improvement is required to be brought about by more emphasis on person centred care for clients and service users and the greater involvement of such people in different aspects of planning, delivery and evaluation (Day, 2006, p 23). The increasing contemporary emphasis on user involvement in the policy and practice of social care is however coming in for increasing questioning from disenchanted service users and service user organisations (Branfield Beresford, 2006, p 2). Service users, whilst highlighting the benefits of their involvement in the social and health care process, are raising various questions about their actual participation in social and health care and the continuance of various barriers that prevent their genuine contribution to the process (Branfield Beresford, 2006, p 2). The case study under question details the results of an enquiry into an episode, wherein a mentally disturbed mother killed her two children after (a) being released from institutional surroundings, and (b) being integrated with her children with the full knowledge and approval of an overseeing group of social, health, nursing and mental health professionals. The enquiry raises disturbing issues about the extent of involvement of service users in social and health care processes and in the decision making of the inter-professional group overseeing the care, treatment and rehabilitation of a mentally disturbed and potentially dangerous individual. The essay investigates the involvement of service users in inter-professional practice in the UK, with specific regard to the case study and the enquiry report. Whilst doing so it takes cognizance of (a) identification of sources for evidence based social work practice, (b) the use of enquiry reports as sources of evidence, (c) the relevance of themes that emerge from such enquiries, and (d) the implications of evidenced based practice for the development of practice in social work. The essay is analysed vis-a-vis the Every Child Matters programme and makes use of legal, political and ethical frameworks. Inter-professional Practice Inter-professional practice and inter-agency collaboration aims to ensure the coming together of service providers, agencies, professionals, carers and service users in order to improve the final level of quality of planning and delivery of services (Mathias Thompson, 2001, p 39. Whilst partnership and collaboration are often considered to be interchangeable, collaboration is the actual foundation for joint working and the basis for all successful partnerships (Mathias Thompson, 2001, p 39). The UK has been enacting legislation and policies for the promotion of Inter-professional and inter-agency collaboration (IPIAC) for the last five decades in order to enhance standards and reduce costs in health and social care (SCIE, 2009, p 1 and 2). The development of IPIAC was shaped by the white paper Caring for People in 1989, followed by the enactment of the NHS and Community Care Act 1990. The government has in recent years issued various policy documents for the promotion of collaboration in order to improve efficiency and effectiveness (SCIE, 2009, p 1). Greater emphasis on IPIAC is expected to improve care because different professional groups like social workers, physicians, teachers and police officers will during the course of such working bring their individual perspectives to the collaborative process (SCIE, 2009, p 1and 2). The IPIAC process will aim to ensure the best ways in which such individual and sometimes differing perspectives can be made to come together, as also the ways whereby respective contributions of different professionals and agencies can be utilised to enhance standards of service and experiences of service users and carers (Freeth, 2001, p 38). Consideration requires to be given to collaboration between organisations, as well as professionals, in the course of IPIAC working. It is also important to consider the differences in the working practices and cultures of the various organisations that are required to work together and to take appropriate action to minimise the impact of such differences in order to make inter-professional practice effective (Freeth, 2001, p 38). Policy makers and practitioners agree that adoption of IPIAC will result in greater service delivery despite the existence of various personal, individual and organisational barriers that can practically hinder its efficiency and effectiveness (Day, 2006, p 23). It is however also widely accepted that effective IPIAC working cannot take place in the absence of deliberate involvement of service users and clients in all stages of planning, delivery and evaluation processes (Day, 2006, p 23). The white paper Modernising Social Services, published in 1998 clearly states that people cannot be placed in neat service categories and users will inevitably suffer if partner agencies do not work together (SCIE, 2009, p 1).It is now mandatory that social work programmes, as well as nursing and midwifery, embrace the involvement of patients and service users. Contemporary government reforms are based on public involvement in different aspects of service delivery (SCIE, 2009, p 2). Person centred approaches in health and social care recognise the need for valuing the opinions and experiences of patients and service users and the adoption of person centred approaches by social work practitioners (SCIE, 2009, p 2). Current research however reveals that service users often feel left out of the process of social care, despite the progressive implementation of IPIAC concepts and approaches (Branfield Beresford, 2006, p 2). Service user organisations state that the knowledge of service users is by and large not taken seriously or valued by professionals and service agencies. Many service users find such attitudes from professionals and agencies to be intensely disappointing and disempowering (Branfield Beresford, 2006, p 3). Agencies and practitioners do not appear to be interested in the information provided by service users and do not accord the respect to such knowledge that they otherwise provide to professional knowledge and expertise. Service users also feel that the cultures of social and health care organisations continue to be closed to service user knowledge and reluctant to change (Branfield Beresford, 2006, p 3). The study of the case review of the episode involving the deaths of child A and child B appears to reinforce the impression of service users about their continued exclusion from the working and decisions of different agencies and professionals involved in delivery of social and health care (Henderson, p 261). The Every Child Matters Programme requires social work agencies and professionals like social workers, health care specialists, teachers, nurses, doctors and mental health professionals to constantly ensure the safety, security and protection of children wherever they can. Extant legislation and policies like The Children Act 2004 and the Every Child Matters Programme clarify that it is everyoneà ¢Ãƒ ¢Ã¢â‚¬Å¡Ã‚ ¬Ãƒ ¢Ã¢â‚¬Å¾Ã‚ ¢s job to ensure the safety of children (Henderson, p 261). The report clarifies that various agencies were involved in the assessment and treatment of Ms. C, the wife of Mr. D and the mother of the two children, child A and child B. The report further reveals that agencies, as well as individual practitioners, failed to consider the views, opinions, and experiences of service users, even as it also contains a number of examples of sound agency and inter-agency practice. There is limited evidence of professional contact with Mr. D, the father of the children, after the contact session in October 2006, and it appears likely that professional networks assumed the agreement of Mr. D with arrangements for Ms. C. Professionals also paid inadequate attention during their provisioning of support to Ms. C, in response to her request for re-housing, and did not communicate with Mr. D to ensure that future arrangements would serve the best interests of the children. Interviews conducted with Mr. D and his parents also revealed significant differences b etween their expectations of the roles of social workers roles and what was implied by the records kept in the agency. Mr. Dà ¢Ãƒ ¢Ã¢â‚¬Å¡Ã‚ ¬Ãƒ ¢Ã¢â‚¬Å¾Ã‚ ¢s family members, it appears, were clearly under the impression that they had little choice in the rehabilitation process and were furthermore required to facilitate the contact of the children with their mother. Whilst the report elaborates the role and sincerity of various agencies and professionals in assessing Ms. Cà ¢Ãƒ ¢Ã¢â‚¬Å¡Ã‚ ¬Ãƒ ¢Ã¢â‚¬Å¾Ã‚ ¢s condition and her rehabilitation in society, it specifically refers to (a) the under involvement of Mr. D in the process, (b) the lack of communication with him (Mr D) by social workers and agencies, (c) the differences in perceptions about the role of social workers between Mr. D and his family and the agency, (d) the poor communication of agencies with the parents, (e) the absence of school records of children, and (e) the scope for improvement of involvement of GPs and the police in the social care process. Although the report makes several recommendations, the specific references to involvement of service users calls for detailed and greater involvement of parents and carers of children in planning of discharge and assessment of risk in order to ensure that actions are based on full information. One of the agencies, the East London and the City Mental Trust has been asked to involve family members and carers of children in all processes, even as the Hackney Children and Young Peopleà ¢Ãƒ ¢Ã¢â‚¬Å¡Ã‚ ¬Ãƒ ¢Ã¢â‚¬Å¾Ã‚ ¢s Service has been directed to ensure that decisions are not taken on issues that can affect children without communicating carefully and appropriately with current carers. Emerging Themes and Evidenced Based Practice The revelations of the enquiry into the report reveal a number of themes in different areas of inter-professional practice, inter-agency working and the involvement of service users in planning, delivery, and evaluation of health and social care, which can be beneficially used to inform future social work practice. The report specifically refers to (a) the lack of participation of services users in social and health care processes, and (b) the involvement of different agencies in their exclusion, thereby reinforcing the need for greater emphasis by agencies and practitioners on involvement of service users in their care plans. It also becomes obvious that much of the sentiments and ideas about involvement of service users in social care processes continues to remain in the realm of rhetoric and that it will need determined and deliberate effort by practitioners to truly bring services users into the actual planning, intervention and evaluation functions of social work practice. Enquiry reports serve as important sources of evidence for development of future social work practice. The impact of the enquiry conducted by Lord Laming into the death of Victoria Climbie led to the revelation of evidence on gross inadequacies in the social care system for children and widespread organisational malaise (Roberts Yeager, 2006, p 19). The publication of the report led to radical changes in governmental policy on social care for children and to the introduction of the Every Child Matters Programme and other important policies for the physical and mental welfare of children (Roberts Yeager, 2006, p 19). The utilisation of research evidence for guidance of practice and development of policies in the area of social services and health care is becoming increasingly important for enhancing the effectiveness of social and health care interventions, especially so because of the limited available resources with the government and the pressures to achieve positive outcomes (Johnson Austin, 2005, p 5). Scholars however feel that much of research based evidence is not absorbed by practitioners and have identified five important requirements for research evidence to practically influence practice and policy, namely (a) concurrence on nature of evidence, (b) a strategic approach to the conception of evidence and the progression of an increasing knowledge base, (c) effective distribution of knowledge along with development of useful means for accessing knowledge, (d) initiatives for increasing use of evidence in policy and practice, and (5) a range of actions at organisational level to increase use of evidence (Johnson Austin, 2005, p 5). Conclusions This study investigates the conduct of inter-professional practice in areas of social and health care, with specific regard to the involvement of service users in such practice. The case study prepared by the City and Hackney Local Safeguarding Children Board on Child A and Child B is specifically taken up contextual review. Inter-professional practice aims to ensure the collaborative working of service providers, agencies, professionals, carers and service users in order to improve the planning and delivery of services. Policy makers and practitioners also agree that whilst adoption of inter-professional working is likely to lead to improved care, it cannot occur without the involvement of service users in all stages of the care process. Person centred approaches also recognise the importance of considering the opinions and experiences of service users in planning, intervention and evaluation of care. Contemporary research however reveals that service users feel that their knowledge is not valued by professionals and agencies. The results of the enquiry reinforce the possibility of service users being excluded from the working of agencies and professionals and refer to a number of instances, where the opinions of the service users were not considered for taking of practice and intervention decisions. The report reveals a number of themes in different areas of inter-professional practice that can be beneficially used to inform future social work practice. The use of research evidence for guidance of practice in social work is becoming increasingly important for improving the effectiveness of social and health care interventions. Enquiry reports serve as important sources of evidence for development of future social work practice. Scholars however feel that much of research based evidence is used by practitioners and that certain specific conditions, which have been elaborated in the last section, need to be met for the improvement and application of evidence based practice. Word Count: 2530, apart from bibliography
Saturday, July 20, 2019
A Silent Mutation With Unknown Mechanism Biology Essay
A Silent Mutation With Unknown Mechanism Biology Essay A silent mutation with unknown mechanism of C1311T in exon 11 combined with IVS11 T93C (G6PD 1311/93) has been reported in G6PD deficient individuals in many populations. In our previous study, G6PD 1311/93 was identified as the common G6PD variant in one of the Malaysian aboriginal groups. Here, we report the screening for this variant via PCR-RFLP method and then direct sequencing of the entire 3 ´UTR of the G6PD gene in 175 aboriginal volunteers and 45 non-aboriginals. In the aboriginal group, 72 individuals (41%) carried the G6PD 1311/93 while 6 individuals (13%) were identified in the non-aboriginal set. Three novel SNPs, ss218178027 (+272 G/A), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) were discovered in 3 ´UTR. SNP ss218178024, which is located inside an AG-rich region, has shown a significant association with G6PD 1311/93 as it was observed solely in individuals with G6PD 1311/93. Computational analyses indicated that three miRNAs have potential to bind to the reg ions encompassing ss218178024. Whilst transitions of A to G dose not destroy these miRNA target sites, it extensively alters the mRNA secondary structure and creates a putative hsa-miR-877* binding site. Notably, ss218178027 and ss218178028 do not change mRNA secondary structure. It could be speculated that ss218178024 have a potential functional effect on the down-regulation of mRNA and consequently G6PD deficiency either by affecting mRNA secondary structure or mirRNA regulation process. This is the first report of clinical association of a SNP in 3 ´UTR of G6PD mRNA. Genetic variations in the G6PD gene are responsible for G6PD deficiency in humans. More than 140 ethnic reliant nucleotide variations in the G6PD gene have been reported (Nkhoma et al 2009). Most of these variants are single missense mutations, with the rest being either double or triple missense mutations or small in frame deletions (Cappellini, G Fiorelli 2008). All these mutations alter the protein sequence of the G6PD enzyme by either amino acid substitution except for a silent mutation of C1311T in exon 11 combined with IVS11T93C (designated here as G6PD 1311/93). This genotype has been reported in G6PD deficient individuals in different ethnic populations with different frequency (Vulliamy et al. 1991; 2000; Jiang et al. 2006; Daoud et al. 2008; Jalloh et al. 2008; Wang et al. 2008; Moiz et al. 2009 ). This combination is a special G6PD variant where the carrier is deficient without any changes to the protein sequence of the G6PD enzyme. From previous studies, association of th ese two has been shown as significant in reducing G6PD enzyme activity in some individuals and hence has clinical implications (Yu et al 2004; Wang et al 2008; Jiang et al 2006). It is notable that some of the individuals with G6PD 1311/93 presented with normal G6PD activity (Jiang et al 2006). Bearing in mind, it is reasonable to postulate that other change(s) in the G6PD gene with potential linkage disequilibrium by this combination is responsible for the enzyme deficiency. Importance of 3 ´UTR of human genes in the post-transcriptional regulation has been supported by finding of functional SNPs in the 3 ´UTR of a number of genes (ref). In the other word, genetic variations in the 3 ´UTR of some genes are associated with variety of human disease ( ref ). Cis-acting elements in the 3 ´UTR of human genes are key players in controlling of mRNA stability, localization and level of translation (ref). Conversely, according to a recent systematic search, 106 conserved motifs located in the 3 ´UTR of human gene are associated with post-transcriptional regulation which half of them likely are miRNA binding sites (Xie et al 2005). MicroRNAs (miRNAs) are a class of genes encoding short RNAs, which are known to inhibit gene expression by binding to the 3 ´UTR of the target transcript. Notably, miRNAs are predicted to regulate about 30% of all human genes by targeting sequences in their 3 ´UTR (ref) . Noteworthy, several SNPs inside the miRNA gene and the miRNA binding sites have been identified recently (ref). The associations of these SNPs with some disease like Parkinson and some kind of cancer have been documented (Sethupathy 2008; Shen 2008). Given that, in the present study, we sought to determine if any SNP in the 3 ´UTR of G6PD gene in G6PD 1311/93 is involve in the regulation of mRNA processing. Subjects and Methods This study was approved by the University Kebangsaan Malaysia (UKM) hospitals ethics committee. All subjects gave their written informed consent. In our previous study, we attempted to identify the molecular basis of G6PD deficiency in 25 deficient individuals from one of the Malaysia aborigine group, namely, the Negrito (data in press). Our earlier results showed that G6PD 1311/93 is the commonest G6PD variant in Negrito. No other mutations were detected in the remaining exons or adjacent regions of the G6PD gene for subjects with G6PD 1311/93. In the present study, blood was collected from 175 consenting volunteers from four sub-ethnic groups of Negrito namely Kintak, Lanoh, Jahai, and Bateq. A series of 45 non-aboriginal volunteers were selected as the reference group. Genomic DNA was extracted by using the Salting Out method (ref). The oligonucleotides used as primers were either designed by online primer-BLAST program or obtained from published data (Kurdi-Haidar et al. 1990). The G6PD gene sequence was obtained from NCBI (reference sequence NC_000023.9). Sequence of each exon was obtained from ENSEMBL (Transcript ENST000 00393562). Then two regions of the G6PD gene (region ab and cd in figure 1) were amplified using the PCR technique to detect variation in nt 1311 in exon 11and nt 93 in intron 11. A proportion of the PCR product from regions ab (207 bp) and cd (317 bp) were digested with the appropriate restriction enzyme according to the manufacturers instructions (New England Biolabs) and then run on 3% agarose gels, stained with ethidium bromide, and photographed under UV light. Region ab was digested with BclI and region cd was digested with NlaIII. For all samples, PCR direct sequencing was performed for 3 ´ UTR of G6PD gene by using 2 sets primer of ef (320 bp) and gh (397 bp). Figure 1: Schematic map of part of G6PD gene (exon 10 to exon 13). The arrows point to the positions of each primer site. Oligonucleotides a: 5 AAGACGTCCAGGATGAGGTGATC 3 and b: 5 TGTTCTTCAACCCCG AGGAGT 3 are the primers used to detect 1311 C>T transition. Oligonucleotides c: 5 TGGCATCAGCAAGACACTCTCTC 3 and d: 5 CCCTTTCCTCACCTG CCATAAA3 are the primers used to detect IVS11 nt93 T>C. Oligonucleotides e: 5 GAGCCCTGG GCACCCACCTC 3 and f : 5 TCTGTTGGGCTGGAGTGA 3 were amplified part of 3UTR and oligonucleotides g (5TCACTCCAGCCCAACAGA3) and h (5 GGTCCTCAG GGAAGCAAA 3) were amplified the rest of 3UTR of G6PD gene for sequencing. Bioinformatic Tools We used two computational tools for each section to confirm our results. F-SNP (http://compbio.cs. queensu.ca/F-SNP/) (Lee Shatkay 2008) and FASTSNP (http://fastsnp.ibms.sinica.edu.tw) (Yuan et al. 2006) was used to find putative functional SNP in 3 ´UTR of G6PD gene. The RegRNA program (http://regrna.mbc.nctu.edu.tw/) (Huang et al. 2006) and MicroInspector (http://bioinfo. uni-plovdiv.bg/microinspector/) (Rusinov et al. 2005) was utilized to identify the miRNAs binding sites inside 3 ´UTR of G6PD gene. Secondary structures of the full-length of G6PD mRNA and as well, 3 ´UTR was predicted using GeneBee (http://www.genebee.msu.su/genebee.html) and mFold (http://mobyle.pasteur.fr/cgi-bin/portal.py) (Zuker et al. 1999). The program RNAhybrid (http://bibiserv. techfak.uni-bielefeld.de/cgi-bin/rnafold_submit) (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy hybridisation of mRNA and miRNA. Results Genotyping DNA from 175 aboriginals and 45 non-aboriginals were screened for presence of G6PD 1311/93. In overall 72 aboriginal individuals (41%) and 6 non-aboriginal subjects (13%) carried this combination (table 1). Through direct sequencing of DNA fragments, three novel SNPs, of ss218178027 (+272 A/G), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) was found (Figure 2). SNP ss218178027 was observed in 6 subjects in aboriginal group with G6PD 1311/93 (table 1) inside of an AG-rich region (AGAAGGAAGGAGGAGG). SNP ss218178028 was observed in 4 aboriginal individuals which 3 of them carried normal alleles in 1311 and 93. None of our non-aboriginal samples carried ss218178027 or ss218178028. SNP ss218178024 also surrounds by other 30 bp AG-rich sequence (gggagggagggacaag ggggaggaaagggg) and it was observed in all those G6PD deficient individuals who carried G6PD 1311/93. In the absence of G6PD 1311/93, ss218178024 was not found. Females who were heterozygote for the G6PD 1311/93 were also heter ozygote for ss218178024. Figure 2. Partial nucleotide sequence of normal, heterozygote and homozygote females respectively for forward strand of ss218178024 (a1, a2, a3), reverse strand of ss218178027 (b1, b2, b3) and reverse strand of ss218178028 (c1, c2,c3). Arrows show position of each SNP. Table 2 SNP Individuals with G6PD 1311/93 individuals normal for G6PD 1311/93 ss218178024 ss218178027 ss218178028 Aboriginal individual 72 105 72 6 4 Non-aboriginal individual 6 37 6 0 0 Bioinformatics Analysis Search for reported SNPs inside of 3 ´UTR of G6PD gene By using F-SNP and FASTSNP programs, we found six SNPs have been reported inside of 3 ´UTR of G6PD gene including SNP ref ID: rs1050831, rs1050774, rs1050773, rs1050830, rs1063529, rs1050757. The last one is actually same with ss218178024. All of these known SNPs were discovered via cDNA sequencing and to date no clinical associations have been reported for them. Prediction of putative miRNA binding sites and mRNA secondary structure The wild sequence of 3UTR of G6PD was submitted to regRNA and MicroInspector programs to detect putative miRNAs target sites. The mutant variant of ss218178024, ss218178027 and ss218178028 was also submitted to evaluate effect of each SNP on creating or destroying the miRNAs target sites. However, in silico analysis indicated that three miRNAs have potential to bind to the regions encompassing ss218178024A. Of note, SNP ss218178024 is located inside seed region of these miRNAs which are hsa-mir-204, hsa-mir-211 and has-mir-1249 (figure 3). Moreover, further computational analyses reveal that transition of A to G in SNP ss218178024 creates additional miRNA target site for has- miR-877* which also is located inside seed region. Neither ss218178027 nor ss218178028 is targeted by any miRNA. The RNAhybrid program (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy (MFE) hybridisation of mRNA and each miRNA. Figure 3 The predicted binding site for hsa-mir-211(A), hsa-miR-1249 (B), hsa- mir-204 (C) and hsa-miR-877* (D) at 3 ´UTR of G6PD gene. Perfect Watson-Crick or wobble base pairings between the 5 ´ end of the miRNA and the 3à ¢Ã¢â€š ¬Ã‚ ² UTR target sites was observed. The minimum free energy (kcal/mol) of hybridization is shown in parentheses. Position of ss218178024G is indicated by arrows. Using the program mFold and Genebee, we determined the potential effect of the SNP sequence alterations on RNA folding. As shown in figure 4, ss218178024G is predicted to alter the secondary structure of G6PD mRNA. Also, the free energy of full length mRNA and as well 3UTR predicted to be affected by this substitution. The lower free energy in wild type indicates that mRNA might be more stable in wild type compare with the mutant. In the other word, it is suggesting that altered mRNA is capable to faster degradation. We also submitted the substituted nucleotide sequences of ss218178027A and ss218178028C to the GeenBee and mFold server. No change in the secondary structure of neither full length mRNA nor 3UTR was observed. It might be assuming that ss218178027A and ss218178028C do not probably modify mRNA processing. Consequently, secondary structure of 3 ´UTR of G6PD mRNA has been also checked for the accessibility of miRNA binding site. A stable base-paired duplex observe in the allele A (figure 4a2) and improper binding for allele G (figure 4b2) (arrows show position of changes). Then, it can be assume that miRNAs can be bind to the target site in mRNA due to the accessible site in the substitution of ss218178024G. Genotype Change in secondary structure Change in secondary of full length of mRNA structure of 3 ´UTR 1311T No ss218178024G Yes Yes 1311T+ ss218178024G Yes ss218178027A No No 1311T + ss218178027A No ss218178028T No No 1311T + ss218178028T No Figure 4 Predicted secondary structures of full length wild-type mRNA (A1) and 3 ´UTR (A2) compare with predicted secondary structures of full length mRNA relating to allele 1311T plus ss218178024G (B1) and 3UTR relating to ss218178024G (B2). The free energy (kcal/mol) of the full-length mRNA and 3UTR is shown in parentheses. Statistical Analysis Discussion A recent systematic study of G6PD deficiency indicated a global prevalence of 4.9% with varying frequencies among different ethnicities (Nkhoma et al. 2009). Although comprehensive studies have identified the molecular basis of G6PD deficiency worldwide, some pertinent questions remain to be addressed. For instance, several studies have reported deficient samples with unknown mutation(s) (Ara ´mbula et al. 2000; Nuchprayoon et al. 2008; Barisic 2005; Laosombat 2005; Pietropertosa 2001; Jiang et al. 2006). Additionally, the silent mutation genotype of C1311T in exon 11 combined with IVS11T93C (G6PD 1311/93) does not explain the phenotype of G6PD deficiency in their carriers. Since there are appears to be no clear linkages to known sequence mutations with these examples, factors extrinsic to the G6PD gene sequence information need to be investigated. These factors may include the roles played by mRNA processing, the untranslated regions (UTRs) and regulatory function by miRNAs. To th e best of our knowledge the importance of mRNA processing and regulation by miRNAs has not been extensively studies with regards to G6PD deficiency. The roles of the UTRs of the G6PD gene have also not received much attention. Our literature search revealed two reports which had evaluated the role of the 3 ´UTR of G6PD gene in their respective deficient population and these reports did not reveal any SNP in the 3 ´UTR for G6PD deficient individuals (Nguyen Thi Hue 2009; Karadsheh 2005). Our present study attempts to shed light on the possible role(s) of the 3UTR of mRNA in G6PD deficiency, especially in the case of G6PD 1311/93. The roles in disease phenotypes played by sequence polymorphisms of the 3 ´UTR have been reported (Lambert et al. 2003; Goto et al. 2001; Yang et al. 2007). Here, we present the possibility that the SNP ss218178024 which we have identified in an AG-rich region of the G6PD 3UTR may participate in mRNA processing and can therefore be correlated with G6PD deficiency. There is, however, accumulating evidence on importance of some elements in the 3UTR like AU-rich, C-rich, CU-rich and AG-rich elements relating to mRNA stability by affecting mRNA secondary structure (SS). For instance, functional SNPs were found to occur within AG-rich elements in some genes like Factor VII (Peyvandi et al. 2005), CYP2A6 gene (Wang et al. 2006), PTPN1 (Di Paola et al. 2002) and NPR1 (Knowles et al. 2003). Therefore, to gain further insights into the role of ss218178024 in G6PD deficiency, we have analyzed the SS of both full length mRNA and 3UTR. Significant alteration was predicted in the SS of full len gth mRNA when we submitted the combination of 1311T and ss218178024G. Whilst in the SS of 3UTR, we observed a possible standard Watson-Crick paired duplex in allele A whereas allele G has a reshuffling of the base pairings resulting in a differing SS prediction for the RNA sequence. The role of structure on RNA function is akin to that of protein. Interestingly, SS of the either full length of mRNA or 3UTR including two substitutions of 1311T and ss218178027A or 1311T and ss218178028C was same with the SS of wild mRNA. This data is good in agree with Chen et al. (2006) which reported that non-functional SNPs in a gene usually have same secondary structure, but the functional SNPs usually change the mRNA secondary structure. Consequently, the free energy is affected by base substitution at ss218178024. In thermo stability point of view, the lower free energy (- 661.6 kcal/mol) in the SS of wild mRNA might be result in a more stable mRNA than mRNA with 1311T and ss218178024G. On the o ther view, SS contributes to interaction of regulatory elements with their target sequence in mRNA. In general, when target sequence is part of a stable base-paired with the other sequence of mRNA, the capacity of regulatory elements like miRNA to get involved in translational regulation could be diminished. Similarly, Hew et al. (2000) have been reported that an AG-rich region in elastin mRNA in chicken may affect mRNA stability and they proposed that alteration in SS in this region can affect the accessibility of endogenous RNse to the mRNA. Therefore, we postulated that miRNA binding site likely is not accessible in the wild mRNA due to its SS. When ss218178024G result in different mRNA SS the miRNA can access the target site as perfect complimentary of seed region is a key to the miRNA regulation. Nevertheless, recent evidence has discovered the significant miRNA expression in erythrocytes which dramatically altered in Sickle cell Disease (ref). Thus, our hypothesis in miRNA reg ulation of G6PD mRNA is reasonable. While, SS is able to modify half life of mRNA, it is also capable to influence interaction of specific sequence of mRNA with regulatory proteins or miRNAs. . Site accessibility is thought to affect the activity of a miRNA binding site. If the secondary structure is such that a potential miRNA binding site is part of a stable base-paired duplex, these bonds will need to be broken before miRNA::mRNA interaction can take place, effectively decreasing the fraction of mRNA molecules of a particular gene which is regulated by a miRNA in question. This could be one of the reasons some of the computational-predicted binding sites are inactive. Here, we demonstrate that a A357G mutation may potentially change the 3 ´UTR secondary structure and create a binding site for hsa-miR-877* affects G6PD expression by either inhibiting mRNA translation or inducing mRNA degradation (Can you explain this bit to me again when we meet). However, we gave evidence for the relevance of the SNP rs3 in G6PD deficiency in G6PD 1311/93 and possible explanation is linkage disequilibrium between this SNP with combination of 1311/93 inside of G6PD gene that might be affect the mRNA translation or stability through miRNA function. In conclusion, to the best of our knowledge, this study reports for the first time an association of a 3 UTR variant of G6PD in a large populations of G6PD 13111/93. However, functional studies are necessary to test this hypothesis. MicroInspector (http://www.imbb.forth.gr/microinspector) (Rusinov et al. 2005) W696-W700 Nucleic Acids Research, 2005, Vol. 33, Web Server issue MicroInspector: a web tool for detection of miRNA binding sites in an RNA sequence Ventsislav Rusinov, Vesselin Baev, Ivan Nikiforov Minkov and Martin Tabler Typically, SNPs occurring in functional genomic regions such as protein coding or regulatory regions are more likely to cause functional distortion and, as such, more likely to underlie disease-causing variations. Current bioinformatics tools examine the functional effects of SNPs only with respect to a single biological function. Therefore, much time and effort is required from researchers to separately use multiple tools and interpret the (often conflicting) predictions. (F-SNP Lee at al) The variant ESR1_rs2747648 affects the miRNA-binding site of miR-453, miR-181(b/d) and miR-219. Due to in silico analysis using miRanda (http://www.microrna.org/microrna/home.do), the variant ESR1_rs2747648 does not significantly effect the binding capacity of miR-219 and miR-181(b/d). However, the binding capacity of miR- 453 is stronger when the C variant allele is present, enabling to bind the complementary G nucleotide of the miR-453 seed. In contrast, the T allele attenuates the binding of miR-453, which we hypothesize to lead to a reduced miRNA-mediated ESR1-repression, in consequence higher ESR1 protein levels and an increased breast cancer risk. Therefore, the breast cancer protective effect observed for the C allele is biologically reasonable. However, functional studies are necessary to test this hypothesis. Due to the fact that endogenous estrogen levels are high premenopausal and drop down post-menopausal, it is plausible that the risk effect of this variant can only be detected in premenopausal women. RNA secondary structure prediction was carried out using the Vienna RNA Package 1.7.2. on the web interface for online RNA folding on the Vienna RNA WebServers.42 The target mRNA prediction was carried out using The microRNA.org resource This is likely because miRNA-mRNA binding is mediated by the RISC complex, and upstream and downstream regions of miRNA binding site may interact with RISC, which mediates miRNA-mRNA binding (26). A polymorphism in the 829C site (SNP-829C3T) is located near the miRNA binding site. 2007 Mishra mirna SNP rs12720208 is located 166 bp downstream of the terminating codon of FGF20 and lies within a predicted binding site for microRNA (miRNA) miR-433. (A) The predicted binding site for miR-433 at 30 UTR of FGF20 gene. At rs12720208, allele C base paired with G in Watson-Crick mode (as shown with a solid line), whereas allele T wobble base paired with G (as shown with a dashed line). ØØ ² Ù†¦Ãƒâ„¢Ã¢â‚¬Å¡ÃƒËœÃƒâ„¢Ã¢â‚¬Å¾Ãƒâ„¢Ã¢â‚¬ ¡ geenbee 2009 capasso Although the mechanism by which interaction of proteins with the G3A sequence might affect message stability remains a matter of speculation, the fact that this sequence is located within a large region of stable secondary structure in the 39-UTR of the elastin mRNA (4) suggests the possibility that RNA/protein interactions at this site may alter the stability of this secondary structure, perhaps affecting the accessibility of endogenous RNases to the mRNA. However, detailed understanding of the mechanism of this process awaits further characterization of the nature of binding protein and the consequences of its interaction with the G3A motif in elastin mRNA. Acknowledgment-We acknowledge GA rich Hew From a physical point of view, we expect that the interaction of a miRNA with its target will depend on the state of the target region prior to interaction. In particular, if the target sequence is already bound (by Watson-Crick base-pairing) to another section of the mRNA chain, this will e_ectively pose a barrier to the base-pairing with the miRNA, and the capacity of such target sequences to mediate translational repression could be diminished. If we were able to predict the accessibility of a potential miRNA binding site, this might improve our target predictions. gi|109132849|AGGGACAGCCCAGAGGA CTGAGCCACCTCCTGCGCTCACTCCAGCCCAACAGAAGGAAGGAGGAGGG gi|108773792| CTGAGTCACCTCCTCCACTCACTCCAGCCCAACAGAAGGAAGGAGGAGGG gi|194680256| CTGAGCCCCCCCCCCCCCACCCCACCGCCCGG-AGCAAGGAAGAGGAGGG ***** * ** ** * * * * * **** ** * * * ******** gi|109132849|AGGGACAGCCCAGAGGA TGCCCATTCGTCTGTCCCAGAGCTTCTCGGTCACTGGGGCTCACTCCTGA gi|108773792| CGCCCATTCGTCTGTCCCAGAGCTTATTGGCCACTGGGTCTCACTCCTGA gi|194680256| CTATAGTTGGGGAAGACAGGGGCAAGGTCCTCAGAAGGCCGAGA ** * * * ** ** ** * ** gi|109132849|AGGGACAGCCCAGAGGA GTGGGGCCTGGGGCAGGAGGGAGGGACGAGGGGGAGGAAAGGGGCGAGCG gi|108773792| GTGGGGCC-AGGGTGGGAGGGAGGGACAAGGGGGAGGAAAGGGGCGAGCA gi|194680256| ATGGGCCCCCTGCACCCCCAGTCTCAGCGCCATTCCACATTCCTGGTC It would be anticipated that increased DHFR reduces MTX cytotoxicity in normal cells while conferring resistance in target cells. A comparison of the human and mouse DHFR 39-UTR sequences revealed that only 100 nucleotides downstream from the terminator codon were conserved between the two species (18). Numerous studies have focused on the effects of coding region variants on P-gp expression and function, whereas few noncoding region variants have been investigated. Mechanisms that alter mRNA levels can change mRNA expression and potentially G6PD activity. Recent evidence has demonstrated that the 3UTR of mRNA is an important regulatory site controlling interactions with mRNA degradation machinery (Hollams et al., 2002; Tourriere et al., 2002; Mangus et al., 2003; Wilkie et al., 2003). 3UTR RNA-binding proteins that recognize specific mRNA sequence elements and secondary structure dictate the fate of mRNA transcripts. Polymorphisms in the 3UTR of G6PD could disrupt RNA-protein interactions, resulting in altered mRNA stability. The stability of mRNA may be altered by 3UTR polymorphisms if recognition of specific mRNA sequence and secondary structure by regulatory proteins is disrupted (Shen et al., 1999; Hollams et al., 2002; Tourriere et al., 2002). A polymorphism in the 3UTR of human tumor necrosis factor-_ changes binding affinity for a multiprotein complex that contains the HuR regulatory protein (Di Marco et al., 2001). HuR binds AG-rich elements in the 3UTR of certain genes (Peng et al., 1998) and has been shown to stabilize mRNA containing tumor necrosis factor-_ 3_-UTR sequence motifs (Dean et al., 2001). There is one report that the 3435C_T synonymous variant decreases mRNA stability (Wang et al., 2005), but to our knowledge no pharmacogenetic research of this type has been conducted for ABCB1 3_-UTR variants. Thus, our mRNA half-life data represent novel findings as to the effects the _89A_T, _146G_A, and _193A_G polymorphisms have on ABCB1 mRNA stability and demonstrate the utility of using stable cell lines made with Flp-In technology for these measurements. Similarly
What is a Community? Essay -- Sociology
A community is established when more than two people share the same values and through time this personal connection evolves into a fellowship governed by rituals, traditions, and a particular form of communication that when taken together makes a group of individuals whether living in a specific geographical area or connected by ideals so distinct that their distinguishing marks allow them to stand out from among the crowd. They do not just believe in something like an organization but they need each other to survive and thrive. A good example is the Old Order Amish Mennonite community wherein the community serves as source of identity, strength and provides the reason why they should sustain the community’s way of life. It is important to understand that in order for a community to exist at least three conditions must be met: a) place; b) interest; and c) communion (Smith, p.1). There must be a territory or place where people can congregate or can be seen (Smith, p.1). The location also helps identify the community and differentiate its members from other groups. The common interests shared by the members create a tight-knit community. Some examples of interests found in communities are religion, occupation, ethnic origin and even hobbies. Aside from location and interest one of the most important components is communion. There must be a connection between the members of a particular community. Without this communion, the coming together, a profound sharing of ideas, resources etc., there can be no community but a group of individuals banded together simply because of proximity such as those living in a gated community in an upscale neighborhood but the residents do not know each other. A more technical definiti... ...rd the Amish Mennonite community exemplifies the meaning of community. The community is established and continues to develop because it is a source of identity, strength, and sustainability – the reason why they must exist and perpetuate their way of life until the end of time. Works Cited Cnaan, Ram & Carl Milofsky. Handbook of Community Movements and Local Organizations. New York: Springer Science, 2008. Schwieder, Elmer & Thomas Morain. A Peculiar People: Iowa’s Old Order Amish. Iowa: University of Iowa Press, 1975. Smith, Mark. â€Å"Community.†Accessed 21 October 2010. Available from http://www.infed.org/community/community.htm Bellah ET AL., Robert. "Community, Commitment, and Individuality." Literacies: Reading, Writing, Interpretation. By Terence Brunk. Second ed. New York: W.W. Norton, 2000. 74. Print.
Friday, July 19, 2019
The Truth About the Quebec Issue :: essays papers
The Truth About the Quebec Issue The Canadian unity crisis involving Quebec has been a controversial issue since before the country^s confederation. Surrounding the seemingly unsurpassable dilemma of unity there are three main obstacles. The significant lack of action for Canada on the part of many francaphone Quebecois, prevents any profound attachment to the country on their behalf. A mood of intransigence on the part of Canadians outside Quebec serves to alienate and anger the individuals within the province. A perceived leadership vacuum throughout Canada on behalf of its citizens contributes to a widespread feeling of hopelessness (Reid, 1991). The complexity of, and speculation towards, the Canadian unity crisis masks the infallible truth that while presently, there is no solution to the problem there is some hope for the future. Within the province of Quebec there is a significant lack of patriotism or any real attachment for Canada. In 1995, The Angus Reid Group asked a national sample of Canadians to describe how they personally felt about Canada. Four options were given: * I am strongly attached to Canada-I love the country and what it stands for; * I am attached to Canada, but only so long as it provides me with a good standard of living; * I am not attached to Canada and would prefer to see it split up into two or more countries; and * I would prefer to see Canada amalgamate with the United States. (Reid, 1995) Outside of Quebec, there was evidence of a high level of patriotism with over 85% of Canadians saying that they are deeply attached to the country and what it stands for. In the province of Quebec, only one-third of the population and only 20% of the francophones, displayed this level of affection for Canada. While there is debate over the cause for these statistics, some individuals believed that the statistics were as a result of lingering wounded pride because of the failed Meech Lake accord in 1991. Many Quebecois were insulted by the way that many Canadians outside of Quebec trivialized the situation, and the province^s demands. Others believe that this problem is indirectly the result of Canada^s official bilingual status. The reasoning behind this is that biligualism serves to even further alienate and differentiate the French within the country. This poses a difficult conundrum. Bilingualism can not be abolished because while it serves to alienate, it is also perceived! by the French as preserving their unique culture and identity. One hope is that through Canadian media a new stronger more unified identity can be achieved. Arguably, the CBC is this best forum for this shift in values because of its
Subscribe to:
Posts (Atom)